Article Categories
- All Categories
-
Data Structure
-
Networking
-
RDBMS
-
Operating System
-
Java
-
MS Excel
-
iOS
-
HTML
-
CSS
-
Android
-
Python
-
C Programming
-
C++
-
C#
-
MongoDB
-
MySQL
-
Javascript
-
PHP
-
Economics & Finance
Server Side Programming Articles
Page 1377 of 2109
Dice Roll Simulation in C++
Suppose a die simulator generates a random number from 1 to 6 for each roll. We want to introduced a constraint to the generator such that it cannot roll the number i more than rollMax[i] (1-indexed) consecutive times. Consider we have an array of integers rollMax and an integer n, we have to return the number of distinct sequences that can be obtained with exact n rolls. The two sequences are considered different if at least one element differs from each other. So if n is 2, then rollMax = [1, 1, 2, 2, 2, 3], then the output will ...
Read MoreSuper Pow in C++
Suppose we have to calculate a^b mod 1337 where a is one positive integer and b is an extremely large positive integer given in the form of an array. So if a = 2 and b = [1, 0] then the output will be 1024To solve this, we will follow these steps −Define powerMod() method this takes base and powerm := 1337, ret := 1while power is not 0if power is odd, then ret := ret * base mod mbase := base^2 mod mpower := power / 2return retDefine superPower(), this takes a and bif size of b = 0, ...
Read MoreMeeting Scheduler in C++
Suppose we have the availability time slots lists slots1 and slots2 of two people and a meeting duration d, we have to find the earliest time slot that works for both of them and is of duration d. If there is no common time slot that satisfies the requirements, then show an empty array. Here the format of a time slot is an array of two elements [start, end] representing an inclusive time range from start to end. we can assume that no two availability slots of the same person intersect with each other. That is, for any two time ...
Read MoreWiggle Subsequence in C++
Suppose we have a sequence of numbers that is called a wiggle sequence if the differences between successive numbers strictly alternate between positive and negative. The first difference may be either positive or negative. A sequence with less than two elements is trivially a wiggle sequence. So for example, [1, 7, 4, 9, 2, 5] is a wiggle sequence because if you see, the differences (6, -3, 5, -7, 3) are alternately positive and negative. But, [1, 4, 7, 2, 5] and [1, 7, 4, 5, 5] are not wiggle sequences, the first one because its first two differences are ...
Read MoreRemove Sub-Folders from the Filesystem in C++
Suppose we have a list of folders, we have to remove all sub-folders in those folders and return in any order the folders after removing. Here if a folder[i] is located within another folder[j], it is denoted as subfolder of it. The paths will be like folder1/subfolder2/… etc.Suppose the input is like["/myfolder", "/myfolder/secondfolder", "/another/document", "/another/document/extrafolder", "/another/final"], then the output will be: ["/myfolder", "/another/final", "/another/document"]To solve this, we will follow these steps −sort the folder array based on the length of the pathscreate one map m, and another array ansfor i in range 0 to size of path array – 1s ...
Read MoreLinked List Random Node in C++
Suppose we have a singly linked list, we have to find a random node's value from the linked list. Here each node must have the same probability of being chosen. So for example, if the list is [1, 2, 3], then it can return random node in range 1, 2, and 3.To solve this, we will follow these steps −In the getRandom() method, do the following −ret := -1, len := 1, v := xwhile v is not nullif rand() is divisible by len, then ret := val of vincrease len by 1v := next of vreturn retExample(C++)Let us see ...
Read MoreRange Sum Query 2D - Immutable in C++
Suppose we have a 2D matrix called matrix, we have to find the sum of the elements inside the rectangle defined by its upper left corner using (row1, col1) and lower right corner using (row2, col2).So if the matrix is like −3014256321120154101710305The above rectangle with the blue color defined by (2, 1) and (4, 3), this contains sum 8.So if we perform some query like sumRegion(2, 1, 4, 3), sumRegion(1, 1, 2, 2), sumRegion(1, 2, 2, 4), these will return 8, 11, 12 respectively.To solve this, we will follow these steps −Define a matrix called dp.Initialize the task as followsn ...
Read MoreElimination Game in C++
Suppose we have a list of sorted integers from 1 to n. That is starting from left and ending at right, we have to remove the first number and every other number afterward until we reach the end of the list. We will repeat the previous step again, but this time from right to left, remove the right most number and every other number from the remaining numbers. We will repeat the steps again, alternating left to right and right to left, until one single number remains. We have to find the last number that remains starting with a list ...
Read MoreInteger Replacement in C++
Suppose we have a positive integer n and we can do these operations as follow −If n is even, replace n with n/2.If n is odd, you can replace n with either n + 1 or n - 1.We have to find the minimum number of replacements needed for n to become 1?So if the number is 7, then the answer will be 4, as 7 → 8 → 4 → 2 → 1 or 7 → 6 → 3 → 2 → 1To solve this, we will follow these steps −ret := 0, n := xwhile n > 1if ...
Read MoreRepeated DNA Sequences in C++
Suppose we have a DNA sequence. As we know, all DNA is composed of a series of nucleotides abbreviated such as A, C, G, and T, for example: "ACGAATTCCG". When we are studying DNA, it is sometimes useful to identify repeated sequences within the DNA.We have to write one method to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.So if the input is like “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”, then the output will be ["AAAAACCCCC", "CCCCCAAAAA"].To solve this, we will follow these steps −Define an array ret, n := size of s, create two sets called visited ...
Read More