Arnab Chakraborty

Arnab Chakraborty

3,768 Articles Published

Articles by Arnab Chakraborty

Page 253 of 377

Flip String to Monotone Increasing in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 426 Views

Suppose a string of '0's and '1's is given. That string will be monotonic increasing if it consists of some number of '0's (possibly 0), followed by some number of '1's (also possibly 0.). We have a string S of '0's and '1's, and we may flip any '0' to a '1' or a '1' to a '0'. Find the minimum number of flips to make S monotone increasing. So if the input is like “010110”, then the output will be 2. By flipping we can get “011111” or “000111”.To solve this, we will follow these steps −n := size ...

Read More

Range Sum Query 2D - Immutable in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 475 Views

Suppose we have a 2D matrix called matrix, we have to find the sum of the elements inside the rectangle defined by its upper left corner using (row1, col1) and lower right corner using (row2, col2).So if the matrix is like −3014256321120154101710305The above rectangle with the blue color defined by (2, 1) and (4, 3), this contains sum 8.So if we perform some query like sumRegion(2, 1, 4, 3), sumRegion(1, 1, 2, 2), sumRegion(1, 2, 2, 4), these will return 8, 11, 12 respectively.To solve this, we will follow these steps −Define a matrix called dp.Initialize the task as followsn ...

Read More

Sort Integers by The Power Value in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 296 Views

As we know that the power of an integer x is defined as the number of steps needed to transform x into 1 using the following steps −if x is even then x = x / 2if x is odd then x = 3 * x + 1So for example, the power of x = 3 is 7 because 3 uses 7 steps to become 1 (3 → 10 → 5 → 16 → 8 → 4 → 2 → 1). So if we have some integers lo, hi and k. We have to sort all integers in the interval ...

Read More

Beautiful Array in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 1K+ Views

Suppose for some fixed value of N, an array A is beautiful when it is a permutation of the integers 1, 2, ..., N, such that −For every i < j, there is no such k with i < k < j such that A[k] * 2 = A[i] + A[j].Suppose we have N, we have to find any beautiful array A.So if the input is like 5, then the output will be [3, 1, 2, 5, 4]To solve this, we will follow these steps −Create one array called ret, insert 1 into retwhile size of ret < Ncreate an ...

Read More

Lexicographical Numbers in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 3K+ Views

Suppose we have an integer n. We have to return 1 to n in lexicographic order. So for example when 13 is given, then the output will be [1, 10, 11, 12, 13, 2, 3, 4, 5, 6, 7, 8, 9].To solve this, we will follow these steps −define one array ret of size ncurr := 1for i in range 0 to n – 1ret[i] := currif curr * 10 = n, then curr := curr / 10increase curr by 1while curr is divisible by 10, then curr := curr / 10return retExample(C++)Let us see the following implementation to get better understanding −#include using namespace std; void print_vector(vector v){    cout

Read More

Minimum Increment to Make Array Unique in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 431 Views

Suppose we have an array of integers A, here a move consists of choosing any A[i], and incrementing it by 1. We have to find the least number of moves to make every value in A unique. So if the input is like [3, 2, 1, 2, 1, 7], then the output will be 6, as after 6 moves, the array could be [3, 4, 1, 2, 5, 7], it can be shown with 5 or less moves that it is impossible for the array to have all distinct values.To solve this, we will follow these steps −ret:= 0sort array ...

Read More

Bag of Tokens in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 477 Views

Suppose we have an initial power P, an initial score of 0 points, and one bag of tokens. Now each token can be used at most once, there is a value token[i], and has potentially two ways to use it, these are as follows −If we have at least token[i] power, then we may play the token face up, losing token[i] power, and gaining 1 point.Otherwise when we have at least 1 point, we may play the token face down, gaining token[i] power, and losing 1 point.We have to find the largest number of points that we can have after ...

Read More

Repeated DNA Sequences in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 1K+ Views

Suppose we have a DNA sequence. As we know, all DNA is composed of a series of nucleotides abbreviated such as A, C, G, and T, for example: "ACGAATTCCG". When we are studying DNA, it is sometimes useful to identify repeated sequences within the DNA.We have to write one method to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.So if the input is like “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”, then the output will be ["AAAAACCCCC", "CCCCCAAAAA"].To solve this, we will follow these steps −Define an array ret, n := size of s, create two sets called visited ...

Read More

Bitwise AND of Numbers Range in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 938 Views

Suppose we have a range [m, n] where 0 >= 1;          i++;       }       return m

Read More

Convert Sorted List to Binary Search Tree in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 254 Views

Suppose we have a singly linked list where elements are sorted in ascending order, we have to convert it to a height balanced BST. So if the list is like [-10, -3, 0, 5, 9], The possible tree will be like −To solve this, we will follow these steps −If the list is empty, then return nullDefine a recursive method called sortedListToBST() this will take list start nodex := address of the previous node of mid node from list amid := exact mid nodecreate a new node with value by taking from the value of midnextStart := next of mid ...

Read More
Showing 2521–2530 of 3,768 articles
« Prev 1 251 252 253 254 255 377 Next »
Advertisements