Suppose we have a DNA sequence. As we know, all DNA is composed of a series of nucleotides abbreviated such as A, C, G, and T, for example: "ACGAATTCCG". When we are studying DNA, it is sometimes useful to identify repeated sequences within the DNA.We have to write one method to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.So if the input is like “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”, then the output will be ["AAAAACCCCC", "CCCCCAAAAA"].To solve this, we will follow these steps −Define an array ret, n := size of s, create two sets called visited ... Read More

Suppose we have an integer n. We have to return 1 to n in lexicographic order. So for example when 13 is given, then the output will be [1, 10, 11, 12, 13, 2, 3, 4, 5, 6, 7, 8, 9].To solve this, we will follow these steps −define one array ret of size ncurr := 1for i in range 0 to n – 1ret[i] := currif curr * 10 = n, then curr := curr / 10increase curr by 1while curr is divisible by 10, then curr := curr / 10return retExample(C++)Let us see the following implementation to get better understanding − Live Demo#include using namespace std; void print_vector(vector v){    cout

Suppose we have a 2D matrix called matrix, we have to find the sum of the elements inside the rectangle defined by its upper left corner using (row1, col1) and lower right corner using (row2, col2).So if the matrix is like −3014256321120154101710305The above rectangle with the blue color defined by (2, 1) and (4, 3), this contains sum 8.So if we perform some query like sumRegion(2, 1, 4, 3), sumRegion(1, 1, 2, 2), sumRegion(1, 2, 2, 4), these will return 8, 11, 12 respectively.To solve this, we will follow these steps −Define a matrix called dp.Initialize the task as followsn ... Read More

Suppose we have a list of folders, we have to remove all sub-folders in those folders and return in any order the folders after removing. Here if a folder[i] is located within another folder[j], it is denoted as subfolder of it. The paths will be like folder1/subfolder2/… etc.Suppose the input is like["/myfolder", "/myfolder/secondfolder", "/another/document", "/another/document/extrafolder", "/another/final"], then the output will be: ["/myfolder", "/another/final", "/another/document"]To solve this, we will follow these steps −sort the folder array based on the length of the pathscreate one map m, and another array ansfor i in range 0 to size of path array – 1s ... Read More

Suppose we have some coins. The i-th coin has a probability prob[i] of facing heads when tossed. We have to show the probability that the number of coins facing heads equals target if you toss every coin exactly once. So if the prob array is like [0.5, 0.5, 0.5, 0.5, 0.5] and target is 0, then the output will be 0.03125.To solve this, we will follow these steps −n := size of prob arraycreate one 2d array of size n x (target + 5)set dp[0, 0] = 1 – prob[0] and dp[0, 1] := prob[0]for i in range 1 to ... Read More

Suppose we have the availability time slots lists slots1 and slots2 of two people and a meeting duration d, we have to find the earliest time slot that works for both of them and is of duration d. If there is no common time slot that satisfies the requirements, then show an empty array. Here the format of a time slot is an array of two elements [start, end] representing an inclusive time range from start to end. we can assume that no two availability slots of the same person intersect with each other. That is, for any two time ... Read More

Suppose a die simulator generates a random number from 1 to 6 for each roll. We want to introduced a constraint to the generator such that it cannot roll the number i more than rollMax[i] (1-indexed) consecutive times. Consider we have an array of integers rollMax and an integer n, we have to return the number of distinct sequences that can be obtained with exact n rolls. The two sequences are considered different if at least one element differs from each other. So if n is 2, then rollMax = [1, 1, 2, 2, 2, 3], then the output will ... Read More

Suppose in a gold mine grid of size m * n, each cell in this mine has an integer representing the amount of gold in that cell, 0 means that is empty. We have to find the maximum amount of gold that you can collect under the conditions −Every time we are pointing a cell we will collect all the gold in that cell.From our position we can walk one step to the left, right, up or down.We cannot visit the same cell more than once.Never visit a cell with 0 gold.So if the input is like [[0, 6, 0], ... Read More

Suppose we have two integers low and high, we have to find and show a sorted list of all the Stepping Numbers in the range [low, high] inclusive. A Stepping Number is an integer means all of its adjacent digits have an absolute difference of exactly 1. For example, 321 is a Stepping Number but 421 is not. So if the input is like low := 0 and high := 21, then the result will be [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 21]To solve this, we will follow these steps −create one array tempmake ... Read More

Suppose a string s is given, a k duplicate removal consists of choosing k adjacent and equal letters from string s and removing them causing the left and the right side of the deleted substring to concatenate together. We will repeatedly make k duplicate removals on the given string s until we cannot change any remaining. We have to find the final string after all such duplicate removals have been made. So if the input is like s = “deeedbbcccbdaa”, and k = 3, then the output will be “aa”, at first delete the “eee” and “ccc” and we will ... Read More