Programming Articles

Page 1385 of 2547

Range Sum Query 2D - Immutable in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 484 Views

Suppose we have a 2D matrix called matrix, we have to find the sum of the elements inside the rectangle defined by its upper left corner using (row1, col1) and lower right corner using (row2, col2).So if the matrix is like −3014256321120154101710305The above rectangle with the blue color defined by (2, 1) and (4, 3), this contains sum 8.So if we perform some query like sumRegion(2, 1, 4, 3), sumRegion(1, 1, 2, 2), sumRegion(1, 2, 2, 4), these will return 8, 11, 12 respectively.To solve this, we will follow these steps −Define a matrix called dp.Initialize the task as followsn ...

Read More

match_results prefix() and suffix() in C++

Sunidhi Bansal
Sunidhi Bansal
Updated on 11-Mar-2026 960 Views

In this article we will be discussing the working, syntax and examples of match_results::prefix() and match_results::suffix() functions in C++ STL.What is a match_results in C++ STL?std::match_results is a specialized container-like class which is used to hold the collection of character sequences which are matched. In this container class a regex match operation finds the matches of the target sequence.What is match_results:: prefix()?match_results::prefix() function is an inbuilt function in C++ STL, which is defined in header file. prefix() is used to get the preceding match_results of the object associated with the function. This function returns the reference of the succeeding ...

Read More

Sort Integers by The Power Value in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 303 Views

As we know that the power of an integer x is defined as the number of steps needed to transform x into 1 using the following steps −if x is even then x = x / 2if x is odd then x = 3 * x + 1So for example, the power of x = 3 is 7 because 3 uses 7 steps to become 1 (3 → 10 → 5 → 16 → 8 → 4 → 2 → 1). So if we have some integers lo, hi and k. We have to sort all integers in the interval ...

Read More

Beautiful Array in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 1K+ Views

Suppose for some fixed value of N, an array A is beautiful when it is a permutation of the integers 1, 2, ..., N, such that −For every i < j, there is no such k with i < k < j such that A[k] * 2 = A[i] + A[j].Suppose we have N, we have to find any beautiful array A.So if the input is like 5, then the output will be [3, 1, 2, 5, 4]To solve this, we will follow these steps −Create one array called ret, insert 1 into retwhile size of ret < Ncreate an ...

Read More

Point to next higher value node in a linked list with an arbitrary pointer in C++

sudhir sharma
sudhir sharma
Updated on 11-Mar-2026 291 Views

In this problem, we are given a linked list with a value, link pointer and an arbitrary pointer. Our task is to make the arbitrary pointer point to point the next large value in the list.Let’s take an example to understand the problem, Here, we can see 8 points to 12, 12 to 41, 41 to 54, 54 to 76 which are successive larger elements of the linked list.To solve this problem, we will use the merge sort algorithm to sort elements and use the sort as a linked list for the arbitrary pointer.For this we will use the merge ...

Read More

Lexicographical Numbers in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 3K+ Views

Suppose we have an integer n. We have to return 1 to n in lexicographic order. So for example when 13 is given, then the output will be [1, 10, 11, 12, 13, 2, 3, 4, 5, 6, 7, 8, 9].To solve this, we will follow these steps −define one array ret of size ncurr := 1for i in range 0 to n – 1ret[i] := currif curr * 10 = n, then curr := curr / 10increase curr by 1while curr is divisible by 10, then curr := curr / 10return retExample(C++)Let us see the following implementation to get better understanding −#include using namespace std; void print_vector(vector v){    cout

Read More

match_results size() in C++ STL

Sunidhi Bansal
Sunidhi Bansal
Updated on 11-Mar-2026 183 Views

In this article we will be discussing the working, syntax and examples of match_results::size() function in C++ STL.What is a match_results in C++ STL?std::match_results is a specialized container-like class which is used to hold the collection of character sequences which are matched. In this container class a regex match operation finds the matches of the target sequence.What is match_results::size()?match_results::size() function is an inbuilt function in C++ STL, which is defined in header file. size() is used to get the number of matches of the match_results object associated with it. This function returns a size_type value that is the number ...

Read More

Minimum Increment to Make Array Unique in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 443 Views

Suppose we have an array of integers A, here a move consists of choosing any A[i], and incrementing it by 1. We have to find the least number of moves to make every value in A unique. So if the input is like [3, 2, 1, 2, 1, 7], then the output will be 6, as after 6 moves, the array could be [3, 4, 1, 2, 5, 7], it can be shown with 5 or less moves that it is impossible for the array to have all distinct values.To solve this, we will follow these steps −ret:= 0sort array ...

Read More

Bag of Tokens in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 478 Views

Suppose we have an initial power P, an initial score of 0 points, and one bag of tokens. Now each token can be used at most once, there is a value token[i], and has potentially two ways to use it, these are as follows −If we have at least token[i] power, then we may play the token face up, losing token[i] power, and gaining 1 point.Otherwise when we have at least 1 point, we may play the token face down, gaining token[i] power, and losing 1 point.We have to find the largest number of points that we can have after ...

Read More

Repeated DNA Sequences in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 1K+ Views

Suppose we have a DNA sequence. As we know, all DNA is composed of a series of nucleotides abbreviated such as A, C, G, and T, for example: "ACGAATTCCG". When we are studying DNA, it is sometimes useful to identify repeated sequences within the DNA.We have to write one method to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.So if the input is like “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”, then the output will be ["AAAAACCCCC", "CCCCCAAAAA"].To solve this, we will follow these steps −Define an array ret, n := size of s, create two sets called visited ...

Read More
Showing 13841–13850 of 25,466 articles
Advertisements