Server Side Programming Articles - Page 1803 of 2646

Different Ways to Add Parentheses in C++

Arnab Chakraborty
Updated on 02-May-2020 07:21:21

1K+ Views

Suppose we have a string of numbers and operators, we have to find all possible results from computing all the different possible ways to group the numbers and operators. Here the valid operators are +, - and *. So if the input is like “2*3-4*5”, then the output will be [-34, -14, -10, -10, 10]. This is because −(2*(3-(4*5))) = -34((2*3)-(4*5)) = -14((2*(3-4))*5) = -10(2*((3-4)*5)) = -10(((2*3)-4)*5) = 10To solve this, we will follow these steps −Define a map called a memo.Define a method called solve(). This will take the input string as input.create an array called retif the memo ... Read More

Majority Element II in C++

Arnab Chakraborty
Updated on 02-May-2020 07:17:52

356 Views

Suppose we have one integer array; we have to find those elements that appear more than floor of n/3. Here n is the size of array.So if the input is like [1, 1, 1, 3, 3, 2, 2, 2], then the results will be [1, 2]To solve this, we will follow these steps −first := 0, second := 1, cnt1 := 0, cnt2 := 0, n := size of array numsfor i in range 0 to size of n – 1x := nums[i]if x is first, then increase cnt by 1, otherwise when x is second, then increase cnt2 by ... Read More

Rectangle Area in C++

Arnab Chakraborty
Updated on 02-May-2020 07:14:23

421 Views

Suppose we want to find the total area covered by two rectilinear rectangles in a 2D plane. Here each rectangle is defined by its bottom left corner and top right corner as shown in the figure.To solve this, we will follow these steps −if C = E or A >= G or B >= H or D = H || D

Contains Duplicate III in C++

Arnab Chakraborty
Updated on 02-May-2020 07:11:25

369 Views

Suppose we have an array of integers, we have to check whether there are two distinct indices i and j in the array such that the absolute difference between nums[i] and nums[j] is at most t. And the absolute difference between i and j is at most k. So if input is like [1, 2, 3, 1], then if k = 3 and t = 0, then return true.To solve this, we will follow these steps −Make a set s, n := size of nums arrayfor i in range 0 to n – 1x is index of set element starting ... Read More

Bitwise AND of Numbers Range in C++

Arnab Chakraborty
Updated on 02-May-2020 07:06:53

929 Views

Suppose we have a range [m, n] where 0 >= 1;          i++;       }       return m

Repeated DNA Sequences in C++

Arnab Chakraborty
Updated on 02-May-2020 06:59:41

1K+ Views

Suppose we have a DNA sequence. As we know, all DNA is composed of a series of nucleotides abbreviated such as A, C, G, and T, for example: "ACGAATTCCG". When we are studying DNA, it is sometimes useful to identify repeated sequences within the DNA.We have to write one method to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.So if the input is like “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”, then the output will be ["AAAAACCCCC", "CCCCCAAAAA"].To solve this, we will follow these steps −Define an array ret, n := size of s, create two sets called visited ... Read More

Compare Version Numbers in Python

Arnab Chakraborty
Updated on 02-May-2020 06:51:39

3K+ Views

Suppose we have to compare two version numbers version1 and version2. If the version1 > version2 then return 1; otherwise when version1 < version2 return -1; otherwise return 0. We can assume that the version strings are non-empty and contain only digits and the dot (.) characters. The dot character does not represent a decimal point and is used to separate number sequences. So for example, 2.5 is not "two and a half" or "halfway to version three", it is the fifth second-level revision of the second first-level revision.We can assume the default revision number for each level of a ... Read More

Lexicographical Numbers in C++

Arnab Chakraborty
Updated on 02-May-2020 06:48:59

3K+ Views

Suppose we have an integer n. We have to return 1 to n in lexicographic order. So for example when 13 is given, then the output will be [1, 10, 11, 12, 13, 2, 3, 4, 5, 6, 7, 8, 9].To solve this, we will follow these steps −define one array ret of size ncurr := 1for i in range 0 to n – 1ret[i] := currif curr * 10 = n, then curr := curr / 10increase curr by 1while curr is divisible by 10, then curr := curr / 10return retExample(C++)Let us see the following implementation to get better understanding − Live Demo#include using namespace std; void print_vector(vector v){    cout

Range Sum Query 2D - Immutable in C++

Arnab Chakraborty
Updated on 02-May-2020 06:35:50

446 Views

Suppose we have a 2D matrix called matrix, we have to find the sum of the elements inside the rectangle defined by its upper left corner using (row1, col1) and lower right corner using (row2, col2).So if the matrix is like −3014256321120154101710305The above rectangle with the blue color defined by (2, 1) and (4, 3), this contains sum 8.So if we perform some query like sumRegion(2, 1, 4, 3), sumRegion(1, 1, 2, 2), sumRegion(1, 2, 2, 4), these will return 8, 11, 12 respectively.To solve this, we will follow these steps −Define a matrix called dp.Initialize the task as followsn ... Read More

Remove Sub-Folders from the Filesystem in C++

Arnab Chakraborty
Updated on 30-Apr-2020 13:10:36

322 Views

Suppose we have a list of folders, we have to remove all sub-folders in those folders and return in any order the folders after removing. Here if a folder[i] is located within another folder[j], it is denoted as subfolder of it. The paths will be like folder1/subfolder2/… etc.Suppose the input is like["/myfolder", "/myfolder/secondfolder", "/another/document", "/another/document/extrafolder", "/another/final"], then the output will be: ["/myfolder", "/another/final", "/another/document"]To solve this, we will follow these steps −sort the folder array based on the length of the pathscreate one map m, and another array ansfor i in range 0 to size of path array – 1s ... Read More

Advertisements