C++ Articles

Page 209 of 597

Meeting Scheduler in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 1K+ Views

Suppose we have the availability time slots lists slots1 and slots2 of two people and a meeting duration d, we have to find the earliest time slot that works for both of them and is of duration d. If there is no common time slot that satisfies the requirements, then show an empty array. Here the format of a time slot is an array of two elements [start, end] representing an inclusive time range from start to end. we can assume that no two availability slots of the same person intersect with each other. That is, for any two time ...

Read More

Single Number III in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 488 Views

Suppose we have an array, there exactly two elements appear once, but others are appearing twice. So we have to define a function, that will find these two numbers. So if the given array is like [1, 2, 3, 1, 5, 2], then the output will be [3, 5].To solve this, we will follow these steps −xor_res := 0for i in range 0 to size of numsxor_res := xor_res XOR nums[i]pos := 0while xor_res AND 2^pos = 0, do, increase pos by 1num1 := 0for i in range 0 to size of nums – 1if nums[i] and 2 ^ pos ...

Read More

Remove Sub-Folders from the Filesystem in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 343 Views

Suppose we have a list of folders, we have to remove all sub-folders in those folders and return in any order the folders after removing. Here if a folder[i] is located within another folder[j], it is denoted as subfolder of it. The paths will be like folder1/subfolder2/… etc.Suppose the input is like["/myfolder", "/myfolder/secondfolder", "/another/document", "/another/document/extrafolder", "/another/final"], then the output will be: ["/myfolder", "/another/final", "/another/document"]To solve this, we will follow these steps −sort the folder array based on the length of the pathscreate one map m, and another array ansfor i in range 0 to size of path array – 1s ...

Read More

H-Index in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 874 Views

Suppose we have an array of citations (The citations are non-negative integers) of a researcher. We have to define a function to compute the researcher's h-index. According to the definition of h-index: "A scientist has index h if h of his/her N papers have at least h citations each, and the other N − h papers have no more than h citations each."So if the input is like citations = [3, 0, 6, 1, 7], then the output will be 3, as it indicates that the researcher has five papers, they have got 3, 0, 6, 1, 7 citations respectively. ...

Read More

Range Sum Query 2D - Immutable in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 485 Views

Suppose we have a 2D matrix called matrix, we have to find the sum of the elements inside the rectangle defined by its upper left corner using (row1, col1) and lower right corner using (row2, col2).So if the matrix is like −3014256321120154101710305The above rectangle with the blue color defined by (2, 1) and (4, 3), this contains sum 8.So if we perform some query like sumRegion(2, 1, 4, 3), sumRegion(1, 1, 2, 2), sumRegion(1, 2, 2, 4), these will return 8, 11, 12 respectively.To solve this, we will follow these steps −Define a matrix called dp.Initialize the task as followsn ...

Read More

Integer Break in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 348 Views

Suppose we have a positive integer n, we have to break it into the sum of at least two positive numbers and maximize the product of those integers. We have to find the maximum product we can get. So if the number is 10, then the answer will be 36, as 10 = 3 + 3 + 4, 3 * 3 * 4 = 36To solve this, we will follow these steps −Define a method solve(), this will take n, array dp and flagif n is 0, then return 1if dp[n] is not -1, then return dp[n]end := n – ...

Read More

Repeated DNA Sequences in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 1K+ Views

Suppose we have a DNA sequence. As we know, all DNA is composed of a series of nucleotides abbreviated such as A, C, G, and T, for example: "ACGAATTCCG". When we are studying DNA, it is sometimes useful to identify repeated sequences within the DNA.We have to write one method to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.So if the input is like “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”, then the output will be ["AAAAACCCCC", "CCCCCAAAAA"].To solve this, we will follow these steps −Define an array ret, n := size of s, create two sets called visited ...

Read More

Count Numbers with Unique Digits in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 1K+ Views

Suppose we have a non-negative integer n. We have to count all numbers with unique digits x, where x is in range 0 to 10^n. So if the number n is 2, then the result will be 91, as we want to find numbers from 0 to 100 without 11, 22, 33, 44, 55, 66, 77, 88, 99.To solve this, we will follow these steps −if n is 0, then return 1n := min of 10 and nif n is 1, then return 10ans := 9 and ret := 10for i in range 2 to nans := ans * (9 ...

Read More

Majority Element II in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 389 Views

Suppose we have one integer array; we have to find those elements that appear more than floor of n/3. Here n is the size of array.So if the input is like [1, 1, 1, 3, 3, 2, 2, 2], then the results will be [1, 2]To solve this, we will follow these steps −first := 0, second := 1, cnt1 := 0, cnt2 := 0, n := size of array numsfor i in range 0 to size of n – 1x := nums[i]if x is first, then increase cnt by 1, otherwise when x is second, then increase cnt2 by ...

Read More

Water and Jug Problem in C++

Arnab Chakraborty
Arnab Chakraborty
Updated on 11-Mar-2026 2K+ Views

Suppose we have two jugs with capacities x and y liters. There is an infinite amount of water supply available to us. Now we need to determine whether it is possible to measure exactly z liters using these two jugs. If z liters of water are measurable, we must have z liters of water contained within one or both buckets by the end.We can do these few operations −Fill any of the jugs fully with water.Empty any of the jugs.Pour water from one jug into another till the other jug is completely full or the first jug itself is empty.So ...

Read More
Showing 2081–2090 of 5,962 articles
« Prev 1 207 208 209 210 211 597 Next »
Advertisements