Article Categories
- All Categories
-
Data Structure
-
Networking
-
RDBMS
-
Operating System
-
Java
-
MS Excel
-
iOS
-
HTML
-
CSS
-
Android
-
Python
-
C Programming
-
C++
-
C#
-
MongoDB
-
MySQL
-
Javascript
-
PHP
-
Economics & Finance
Articles on Trending Technologies
Technical articles with clear explanations and examples
Minimum Increment to Make Array Unique in C++
Suppose we have an array of integers A, here a move consists of choosing any A[i], and incrementing it by 1. We have to find the least number of moves to make every value in A unique. So if the input is like [3, 2, 1, 2, 1, 7], then the output will be 6, as after 6 moves, the array could be [3, 4, 1, 2, 5, 7], it can be shown with 5 or less moves that it is impossible for the array to have all distinct values.To solve this, we will follow these steps −ret:= 0sort array ...
Read MoreBag of Tokens in C++
Suppose we have an initial power P, an initial score of 0 points, and one bag of tokens. Now each token can be used at most once, there is a value token[i], and has potentially two ways to use it, these are as follows −If we have at least token[i] power, then we may play the token face up, losing token[i] power, and gaining 1 point.Otherwise when we have at least 1 point, we may play the token face down, gaining token[i] power, and losing 1 point.We have to find the largest number of points that we can have after ...
Read MoreRepeated DNA Sequences in C++
Suppose we have a DNA sequence. As we know, all DNA is composed of a series of nucleotides abbreviated such as A, C, G, and T, for example: "ACGAATTCCG". When we are studying DNA, it is sometimes useful to identify repeated sequences within the DNA.We have to write one method to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.So if the input is like “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”, then the output will be ["AAAAACCCCC", "CCCCCAAAAA"].To solve this, we will follow these steps −Define an array ret, n := size of s, create two sets called visited ...
Read MoreError functions using cmath in C++
We are given the variable and the task is to find the probability of the variable using an error function available in C++ STL. This function is available in the cmath header file in C++.What is an Error function?Error function in mathematics is also known as Gauss error function which is denoted by erf(). It is a special function that is used in probability, statistic and partial differential equations for the calculation of error that can occur. It is defined as −There are two closely related error function −complementary error function − It is defined as erfc x = 1 ...
Read MoreBitwise AND of Numbers Range in C++
Suppose we have a range [m, n] where 0 >= 1; i++; } return m
Read MoreConvert Sorted List to Binary Search Tree in C++
Suppose we have a singly linked list where elements are sorted in ascending order, we have to convert it to a height balanced BST. So if the list is like [-10, -3, 0, 5, 9], The possible tree will be like −To solve this, we will follow these steps −If the list is empty, then return nullDefine a recursive method called sortedListToBST() this will take list start nodex := address of the previous node of mid node from list amid := exact mid nodecreate a new node with value by taking from the value of midnextStart := next of mid ...
Read MoreArray of Doubled Pairs in C++
Suppose we have an array of integers A with even length, now we have to say true if and only if it is possible to reorder it in such a way that A[2 * i + 1] = 2 * A[2 * i] for every 0 0, thenif m[key of kv] is not 0 and m[2* key of kv] > 0x := min of m[key of kv] and m[2* key of kv]cnt := cnt – (x * 2)decrease m[2 * key of kv] by xdecrease m[key of kv] by xotherwise when key of kv = 0, thencnt := cnt ...
Read Moreis_class template in C++
In this article we will be discussing the working, syntax and examples of std::is_class template in C++ STL.is_class template is used to check whether the defined type is class type not any other type.What is a class?A class is an user defined data type or a data structure which contains some data members or member functions which is declared with the keyword ‘class’.Exampleclass abc { int data_members; void member_function(); };So, is_class template checks that the type T is a class, and returns the Boolean value true or false accordingly.Syntaxtemplate is_class;ParametersThe template can have only parameter of type ...
Read MorePrison Cells After N Days in C++
Suppose there are 8 prison cells in a row, and in each cell there is a prisoner or that is empty. In each day, whether the cell is occupied or vacant changes according to the following rules −If one cell has two adjacent neighbors that are both occupied or both vacant, then the cell becomes occupied.Otherwise, it becomes empty.We will describe the current state of the prison in the following way: cells[i] will be 1 if the i-th cell is occupied, else cells[i] will be 0.So we have the initial state of the prison, then return the state of the ...
Read MoreRectangle Area in C++
Suppose we want to find the total area covered by two rectilinear rectangles in a 2D plane. Here each rectangle is defined by its bottom left corner and top right corner as shown in the figure.To solve this, we will follow these steps −if C = E or A >= G or B >= H or D = H || D
Read More